Skip to main content

Table 1 i-motif, G4, hairpin and mutant sequences used in this study

From: In vivo visualization of the i-motif DNA secondary structure in the Bombyx mori testis

Gene IDWild-type and mutant sequences of the i-motif, G4 and hairpinaUsed for
BmPOUM2-WTTTGTTGCCCCGCCCCTCGGCCCCCTCGCGCCCCGCACTGGBmPOUM2-WT in Fig. 1a; ssDNA, i-motif and cold probes in Fig. 2a; i-motif in Fig. 2c, Fig. 2e, Fig. 2g and Fig. 3A(a,b) and Fig. 3C; ssDNA in Fig. 2e.
BmPOUM2-MutTTGTTGTACTGCTACTCGGATCACTCGAGCATCGTACTGGMutant probes in Figs. 1b, 2a
BGIBMGA003213-WTCCCCGCGCCCCCCGCGTCCCCCGCACCCCCBGIBMGA003213-WT in Fig. 1c; ssDNA, i-motif and cold probes in Fig. 2b; i-motif in Figs. 2d,f, 3B(a,b), D; ssDNA in Fig. 2f.
BGIBMGA003213-MutCATTGCGATATCAGCGTTATCAGTATCAATMutant probes in Figs. 1d, 2b
BmPOUM2-G4CCAGTGCGGGGCGCGAGGGGGCCGAGGGGCGGGGCAACAABmPOUM2 G4 in Fig. 2e
BGIBMGA003213-G4GGGGGTGCGGGGGACGCGGGGGGCGCGGGG3213 G4 in Fig. 2f
HairpinCAGTGGCGGCCATCCGTTTAATATTACCGGATGGCCGCGCGATHairpin in Fig. 2e, f
  1. Hairpin was synthesized based on the tomato golden mosaic virus sequence. The i-motif, G4 and mutant sequences were synthesized based on the sequences of BmPOUM2 and BGIBMGA003213 genes
  2. aThe underlined based are mutated