Skip to main content

Advertisement

Table 1 Primer set for qRT-PCR and ChIP-PCR

From: ZEB2 stably represses RAB25 expression through epigenetic regulation by SIRT1 and DNMTs during epithelial-to-mesenchymal transition

Gene Primer sequences 5′ to 3′
ZEB2 CGAGCGGCATATGGTGACA
GCCACACTCTGTGCATTTGAA
RAB25 CTCAGCCCTGGACTCTACCAA
TCCGGATGCTGTTCTGTCTCT
CDH1 CGGTTCCGAAGCTGCTAGTC
TTGAAGCGATTGCCCCATT
EpCAM GCGGCTCAGAGAGACTGTG
CCAAGCATTTAGACGCCAGTTT
VIM1 GACAATGCGTCTCTGGCACGTCTT
TCCTCCGCCTCCTGCAGGTTCTT
SIRT1 TGTGTCATAGGTTAGGTGGTGA
AGCCAATTCTTTTTGTGTTCGTG
HPRT TGACACTGGCAAAACAATGCA
GGTCCTTTTCACCAGCAAGCT
ChIP_RAB25_1 ACCTCAGCCTCCCAAAGT
TGAGGGCTGAGTGTGCAT
ChIP_RAB25_2 CCCAGCAATGCACACTCA
TGGGTGGAGAGATGATGACG
ChIP_RAB25_3 GACACCCAACCTGTCGAACCT
CGGAAGCTGAGAACAGGAAGA
ChIP_RAB25_4 TTTGAGAGCTGAGGGTTGAG
ATCTTCCTCAGTTCCATTCCC
ChIP_CDH1 GGCCGGCAGGTGAAC
GGGCTGGAGTCTGAACTGAC
ChIP_EpCAM TAGCCTCCACGTTCCTCTATCC
TGCTGAGACTTCCTTTTAACCG
ChIP_NC CACTACGCCTGGCTAATTT
TCAGGAGATCGAGACCATC