Skip to main content

Advertisement

Table 4 List of primers used for real-time PCR

From: DNA methylation reader MECP2: cell type- and differentiation stage-specific protein distribution

Gene Forward Reverse
Mbd1* GAGCACAGAGAATCGCCTTC CACACCCCACAGTCCTCTTT
Mbd2* CTGGCAAGATACCTGGGAAA TTCCGGAGTCTCTGCTTGTT
Mbd3* AGAAGAACCCTGGTGTGTGG TGTACCAGCTCCTCCTGCTT
Mbd4* ACAGGATGGCTCTGAAATGC TCTACTTGTGTCCGTGGGATG
Mbd5 isoform 1** GAGGCCATGAGCGAACTG TCTTCCTCCTCTTGGGTTTG
Mbd6** CCCGGGGATAGTCAGAAAGT AGCTGCTCGCGTTGTAGG
Mecp2* CAGGCAAAGCAGAAACATCA GCAAGGTGGGGTCATCATAC
Zbtb33 ATCATTAGCTCCAGTCCAGACTCA ATCTGCATCTTCTGTGTCAATGATC
Zbtb38* CATCTTTTGGAGCCATACGATCT TGACGGTTTCCTGTCTTTTGAC
Zbtb4 CCCTGCCGCTACTGTGAGA CAGCAGAAGATGCACTGGTACCT
Setdb1 GGCCATTCCTCCCCTACTTC GGCCAAAGGTGACCGATATG
Uhrf1 GGCAGCTGAAGCGGATGA CCATGCACCGAAGATATTGTCA
Uhrf2UHRF2 CATGGTCGCAGCAATGATG CACCGCTTCCAGTATACGTGAA
Gapdh CATGGCCTTCCGTGTTCCTA CTTCACCACCTTCTTGATGTCATC
  1. Single asterisk denotes that the sequence was taken from[64]. Double asterisks signify that the sequence was taken from[69].