Figure 4
p57Kip2promoter methylation and NAP1L1 binding. Genomic DNA of normal BON cells and NAP1L1 silenced BON cells were treated with bisulfate, which converted cytosine of unmethylated p57Kip2 promoter into uracil. Methylation-specific polymerase chain reaction (MSPCR) was performed using two p57Kip2 promoter primers (forward first primer, CGCCAATCGCCGTGGTGTTG; forward second primer, ACTACATTATGCTAATCGCG; reverse primer, GCCAGGCCTGAGCGAGCGAG). Unmethylated p57Kip2 promoter resulted in low PCR products as demonstrated for NAP1L1-silenced cells (A) (*p < 0.05) indicating that NAP1L1 controls p57Kip2 expression by methylation of its promoter. In chromatin immunoprecipitation (ChIP) experiments, using the Pierce Agarose ChIP Kit (Thermo Scientific) according to the manufacturer’s instructions, a direct binding of NAP1L1 protein to the p57Kip2 promoter was evident in normal growing BON cells; non-proliferating cells did not silence the p57Kip2 promoter (B) (*p < 0.05). The calculated promoter expression in NAP1L1-bound DNA fragments is shown in relation to the control. Mean ± SEM.