Skip to main content

Table 2 Primers and polymerase chain reaction (PCR) conditions for quantitative reverse transcription PCR

From: Dicer regulates Xist promoter methylation in ES cells indirectly through transcriptional control of Dnmt3a

Region/gene Primer, forward Primer, reverse PCR conditions
Xist, Amp 4 TN4s ttctaccctttcctctcctcatc JTL4as, gaggtacgtaagctcagtga 95°C for 5 minutes; (95°C for 30 seconds; 60°C for 30 seconds; 72°C for 30 seconds) × 40 cycles
Xist, Amp 5 Qmex4, gcaaggaagacaaaggctcaaagaat Qmex52 ggagagagaaccaaatagagcagaat 95°C for 3 minutes; (95°C for 20 seconds; 61°C for 15 seconds; 72°C for 30 seconds) × 40 cycles
Xist, Amp 51 DE-SOL2, tgcaatctttgtggccactcctcttctg TN51, tatcaaaacgtcaaaaatctcg 95°C for 5 minutes; (95°C for 30 seconds; 60°C for 30 seconds; 72°C for 30 seconds) × 40 cycles
Xist mut, Amp 51m DE-SOL2, tgcaatctttgtggccactcctcttctg neoTN9, catcgcattgtctgagtaggtgtc 95°C for 5 minutes; (95°C for 30 seconds; 64°C for 30 seconds; 72°C for 30 seconds) × 40 cycles
Dnmt1 Dnmt1_F1, agatccactgtggcaagaaga Dnmt1_R1, ctgaagttcaccacagcttcc 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt1 Dnmt1_F2, agggaccatatctgcaaggac Dnmt1_R2, gctgctgtagccatttttcac 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3a2 Dnmt3a2_F1, cagacgggcagctatttacag Dnmt3a2_R1, ggttctcttccacagcattca 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3a2 Dnmt3a2_F2, ggctcacacctgagctgtact Dnmt3a2_R2, cctcctccaccttctgagact 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3b Dnmt3b_F1, caagcgcctcaagacaaatag Dnmt3B_R1, gcgatcccggcaactctgaca 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3b Dnmt3b_F2, cgagaacaaaagtcgaagacg Dnmt3b_R2, gggttcttctttccacaggac 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3b Dnmt3b_F3, ccattcttctggatgttcgag Dnmt3b_R3, tctgatggagttcgacttggt 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3L Dnmt3L_F1, cttgtttgagggagggttatg Dnmt3L_R1, gtacagtcggggctctcacag 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3L Dnmt3L_F2, agacaactacccgcttccttc Dnmt3L_R2, ctcttcttcctttggggtcag 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Dnmt3L Dnmt3L_F3, cccctaggcagctcttgtgat Dnmt3L_R3, gcgggtagttgtctcttggtc 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
Idh2 Idh1F, agaaaatgtggaagagccctaacg Idh1R, tgccagctcgatctaccacaaaat 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles
β-actin BA11, gatatcgctgcgctggtcgt BA2, agatcttctccatgtcgtcc 95°C for 3 minutes; (95°C for 20 seconds; 60°C for 20 seconds) × 40 cycles