Skip to main content

Table 5 Biomphalaria glabrata gene-specific primers used to amplify gene fragments used in the RT-qPCR

From: The methylome of Biomphalaria glabrata and other mollusks: enduring modification of epigenetic landscape and phenotypic traits by a new DNA methylation inhibitor

Gene Primer Sequence Amplicon length Primer efficiency
28S ribosomal protein F: GCTGGCACGACCGCTCCTTT 100 bp 2.01
R: TTTGAACCTCGCGACCCGGC
α-Tubulin F: CGACATCTGCCGCCGTAACCT 112 bp 2.04
R: GGCGCCATCAAACCTGAGGGA
BGLTMP010125-RA: F: TTGCTGTGACTGTCAGTGTC 95 bp 1.90
R: TAGACTCAATGGACGGTGGAC