Skip to main content

Table 3 Oligonucleotides used

From: In vivo chromatin organization on native yeast telomeric regions is independent of a cis-telomere loopback conformation

Name Sequence (5′ to 3′) Purpose (description)
pRSdel_F TAACTATGCGGCATCAGAGC Cloning (Deletion of part of pRS plasmid, del4881-142)
NLS_MN_F TTTCTTTGGCGGCATCCTGCAGCCCGGG Cloning (Replacement of GBD sequence with NLS sequence)
TEL05R_F (specific to TEL05R) ACGATCGCGTCATTTTACAATG Cloning (Amplification of XY’ from TEL05R)
TEL03L_F AGCTTTCATCATTCGCGCTGA Probing (DNA fragment specific for TEL03L)
TEL06R_F CATGAGTTCGAGTATGGTGTT Probing (DNA fragment specific for TEL06R)
TEL05R_F ACGATCGCGTCATTTTACAATG Probing (DNA fragment specific for TEL05R)
Y’_XS_F TGGAGTTTTTCAGCGTTTGCG Probing (DNA fragment hybridizing in Y’, downstream of XhoI site, YPX probe)
Y’_TR_F TGAAAATGAAACCCTGTTCTTTAGC Probing (DNA fragment hybridizing in Y’, encompassing Tbf1 and Reb1 binding sites, YTR probe)
qPCR (Primer pair used to determine ChIP signal on Y’)
p05RA_oligo TGCATTACCTTGTCATCTTCAG Probing (Oligonucleotide used to probe p05RA plasmid)
TRP1_F CCGATGCTGACTTGCTGGG Probing (DNA fragment specific for TRP1 locus)
HMR-E 3f CGAACGATCCCCGTCCAAGTTATG qPCR (Primer pair used to determine ChIP signal on HMRE [53])
X(05R)Y_F GGGTTGGTGGTAGGAAGTAGAGGG qPCR (Primer pair used to determine ChIP signal on X(05R)-Y’ junction)
X(16R)Y_F GTGTGGAATATGAAAGTAGGGTAAGTTTGAGATG qPCR (Primer pair used to determine ChIP signal on X(16R)-Y’ junction)