Skip to main content

Table 1 Location of and primers for sites that are positive or negative (yet still in open chromatin) for Tcf7l2 binding

From: Dam mutants provide improved sensitivity and spatial resolution for profiling transcription factor binding

Chr Start End Forward primer Reverse primer
Positive controls
14 49155664 49155815 AAACCACTCTCCCCCAAAGC TTTGAAGTTCCGGAGCGGTT
15 30383190 30383333 CTTAAAAGCAGGCTCCCTCGC TCCACACTTCAAAAGGAGAGAAAG
4 129251719 129251895 ATTTCAAACAAACTCCCCGCTG TGGAATTAGTTTGGGGCTCTGAT
5 74953049 74953184 AAGTGACCCTTTGTTCTCTGTC CAAAGAATGGGCCGGGATG
Negative controls
14 111679747 111681304 ACAGCTTCACTTCCTTGCCA TTTGAATGAGGGAAGTCAGCT
7 10494816 10495738 GCCCTTAGAACCGCTCCTTT TCCAGATCGTGTGCAAGACC
1 99772205 99772613 ACTATTGGTGGAGCTGTGCG TGCTTGCCTTTCTTGCTTGC
3 111370868 111371261 AAGCAGCAAGAGGGAACACT TGCATGCCACAGAATACTTTTAA