Skip to main content

Table 2 Oligonucleotides

From: High-throughput assessment of context-dependent effects of chromatin proteins

Name Sequence (5′–3′)
GFP_f AGGACAGCGTGATCTTCACC
GFP_r CTTGAAGTGCATGTGGCTGT
upstream_f CGTACTCCACCTCACCCATC
upstream_r TTCATCGATACCGTCGACCT
TSR_f CAAAGAAGCAAAAGCTGTTCCTTA
TSR_r GCTGGAGTACAACATCTTCTTCTTGAC
160JvA CTAAGGTAGCGAAGGCAATGCTACCAAATAC
161JvA GACCGTTATAGTTATTTAAATTGTTTAACTTGG
AR152 ACACTCTTTCCCTACACGACGCTCTTCCGATCT
168_JvA /5′phos/NNNNNNNNNNNNNNNNNNNNGATCATGCTAGTTGTGGTTTGTC
169_JvA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCAGTGAAAAAAATGCTT
151AR AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
219AR GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAAGGTGTATGTAAACTTCCGACTTCAACTG
iPCR indexing CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
Library indexing CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCACGCCTTCAAGACCCCCATCGCC
DamID adapter top CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA
DamID adapter bottom TCCTCGGCCGCG
Adr-PCR-Rand1 NNNNGTGGTCGCGGCCGAGGATC
Y-adaptor top ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Y-adaptor bottom /5′phos/GATCGGAAGAGCACACGTCT
Illumina index CAAGCAGAAGACGGCATACGAGNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
P5-Illumina-2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
45JvA ATTCTGATATTTCACATTCTTAAAATAAAGTGG
94JvA ACCGTTATAGTTATTAACTTGGGTCAAACATTT