Skip to main content

Table 3 Primers used in this study

From: Differential expression of histone H3 genes and selective association of the variant H3.7 with a specific sequence class in Stylonychia macronuclear development

Primer     Sequence 5′→3′
ACT1- TTGCTGGCGAAGGTTGAGAG
ACT1+ TGCCAGCCCAGACAGAAGAT
AP1 GTAATACGACTCACTATAGGGC
AP12 GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCT
AP2 ACTATAGGGCACGCGTGGT
H3.1- GTTGCATGTCCTTTGGCATGATGGTAAC
H3.1+ CACCGGTGGAGTCAAGAAAC
H3.2- GAGAGCAAGGACAGCTGATGA
H3.2+ GGTACCGTTGCTCTCAGAGAAA
H3.3- CCTCTGATTCTTCTGGCTAGCTATATATCC
H3.3+ GTCACACTTCACATTTTGTCTC
H3.4- CAAGTTGAATGTCCTTAGGCATGATTG
H3.4+ CCTGCTGATGGTGGAGTT
H3.5- GGGCGAGGACAGCAGATGAT
H3.5+ GAAGATTCCAAAAGAGCACTGAACT
H3.6- GCTAATTGCATATCTTTCGGCATGATG
H3.6+ CCTGCTAATGCCGGAATA
H3.7- AAAGTGCCAGTAGGCCTTGAATACTG
H3.7+ AAGAAACTCCCTTTCCAGAGATTAG
H3.8- TGGCGTGAATGGCGCACAA
H3.8+ CTCAAGGCTCCCTTCCAGAGATT
H4– AAATAGTTGGTTAAAGTTCTCATTC
H4+ ATGATGTGATGTTTTTTTAATGATC
MaA81- TGTGCCAAGAAGGCCAAAGAG
MaA81+ TCAGTATCACCATCTACAACATTCG
Mdp2- AGAAGAGGAGGACCGAGTGG
MDP2a- AAGGAGAGTATAATATGATTGGACTGTTG
MDP2a+ TGCTTGACTGAGTCGTCAGAAT
Mdp2b+ ATCAGTCTCTGAGGGAAATAGGC
pLJ01- TCAAAGAGGTCGATGGTTCC
pLJ01+ ACCTCGATACCGCATACCAG
Stad5- AAACATTCACCCCCAAAGC
Stad5+ CATCAAGGACCGCTATTCCTAC