Skip to main content

Table 4 Oligos

From: The male germ cell gene regulator CTCFL is functionally different from CTCF and binds CTCF-like consensus sites in a nucleosome composition-dependent manner

Oligos used for RACE PCR
Name Forward Backward
RACE GGACACTCGTATTTGGGCACATTC CACAGGGAGCACTTGAAGGGCTTC
Oligos used in real-time PCR for ChIP
Name Forward Backward
Gal3st1 TCCTGGGTGAGGTCAGGAAG GGAACTCCGAGTAGCTTCAATG
Stra8 TCCTAGAGAAGGGGGTGTTACC AGCTGACCACCACACGTTTTC
Prss50 AGAGGAGGGTAGGGGTATCGAC TCGCCTCAGCTAATTTCTAAGC
Vps18 CTGCTGCAGTTCCTCATGTTG GTGTGACAGATGGAGGAGCAC
Chr10 AAGGTTGGTAGCTCTGCTTGGACTGCTCG AATGTCACAAGCAAAGAAAAGCACGCAAAT
Amylase AATTCTCCTTGTACGGCTTCGTG TAGCAATGATGTGCACAGCTGAA
Oligos used in real-time PCR for RNA expression
Name Forward Backward
Clgn TGTCTTCCTTACTCTTCTCTTCCG GAAGCCAGGTGAAGCTGAGGTC
Ctcf CCACCTGCCAAGAAGAGAAGG GCACCTGTATTCTGATCTTCGAC
Tcfl5 ACGAGATAGGAGGCGCAGAATC GTTGTTGCTTTATCTGTCTCCG
Gal3st1testis-specific form GCTACTCGGAGTTCCGGAAA GACTTGCAGGGCTTCTTTGG
Gal3st1 ACTGTATCCCAACATGGCCTTC ATATCTCGCCGAGGTTGACAC
Stra8 GGCAGTTTACTCCCAGTCTGATA CAACTTATCCAGGCTTTCTTCCT
Prss50 GACAGTTCTCTCTGCACTGTGAC CACATTTCTTGCTGTTCAGGATA
Ctcfl GCTCTGGCTGTGCACCTTACG CCCACTGTGCCACCATCATC
Ccna1 GAGTATGCAGAGGAGATTCATCG TCATGTAGTGAGCCTTGGGTCTG
lpcat2 AGCACCCAGTGAGGAAGAGA TTCGTAGGTGTGATCCGTCA
itfg3 ACGAGGTGTCTTCTGCCTGT GTTCCCACTAAAGCTGCTGG
dio2 TGCAGATCCTGCCAGTCTTT CACACTGGAATTGGGAGCAT
hgf GATGAGTGTGCCAACAGGTG GGTCAAATTCATGGCCAAAC
akr1c18 CCAGGCCATTCTAAGCAAGA TCAGGGAATTTTCCAAGCTG
Oligos used in EMSA
Name Forward Backward
Stra8 GGATCTGTGCTGTGTGTCCTCCTCGACTCCT CCTCTAGGAGTCGCAAGTGACCCACACATGCATGC
  AGAGCATGCATGTGTGGGTCACTTGCGACTC  
  CTAGAGGA TCTAGGAGTCGAGGAGGACACACAGCACAGATCCT
Prss50 ATCTAGGGGGCGCCACGCAGGCTGGGCACC CCACAATGGCGCCCTCCATCGGGCGCCTCATGGT
  AGCGCACCATGAGGCGCCCGATGGAGGGCG GCGCTGGTGCCCAGCCTGCGTGGCGCCCCCTAGATG
  CCATTGTGGA  
Oligos used for generating transgenic mice and cells
Name  
Oligo 1 5-TCTTTTTCCATCAGGGGTCGTCAC-3
Oligo 2 5-GAGAAGCGCGATCACATGGTCCTG-3
Oligo 3 5-GCACCGTTTGCAGGGTCAGGATC-3
Oligo 4 5-TCCAAATCACAGCGCCACCTACAG-3
Oligo 5 5-GGTTCTTAGAGATAGGGTTTCTCTG-3
Oligo 6 5-GGTGTTCTGCTGGTAGTGGTC-3
Oligo 7 5-CGGCATCAGAGCAGCCGATTG-3
Oligo 8 5-GTTATGATCTGGGTATCGTCCACTG-3