Skip to main content

Table 3 Oligonucleotides used in the study

From: Mediator regulates non-coding RNA transcription at fission yeast centromeres

Name Sequence
dhH-siRNA TACTGTCATTAGGATTAGCACA
Cen-dh-FOR2 CGACAAACTTCATGTTACAAGTC
GTO265 GCTATTCAGCTAGAGCTGAGGG
GTO266 CTTCGACAACAGGATTACGACC
GTO223 GAAAACACATCGTTGTCTTCAGAG
GTO226 TCGTCTTGTAGCTGCATGTGA
OKR70 GGCATCACACTTTCTACAACG
OKR71 GAGTCCAAGACGATACCAGTG
Act1 q-PCR FW CTGTTTTGTCTTTGTATGCC
Act1 q-PCR RV TAAGGTAGTCAGTCAAGTCA
dhA q-PCR FW GCAAACAGACCCTCATACAG
dhA q-PCR RV CAAGGACTAAGCCCAAGCAC
ura4 q-PCR FW CGTGGTCTCTTGCT TTGG
ura4 q-PCR RV GTAGTCGCTTTGAAGGTTAGG
p33F TGCAAGTGGAAAGTGGCTTCA
p33R TCGACCACCCTGACTTGTTCTC
p30F CCTGTTGATTCGGCACCTTTG
p30R TGGAGAACGACTGTGAAGAGA
oMiT127 CCGAAAGCCTCGATATCATC
oMiT128 GAGCATGGTGGTGGTTATGG
oMiT142 ACCGTAGTACGACGATGATGTGTTT
oMiT143 ACATTCCGCACAAGGTCTAGTACA