Skip to main content

Table 2 Primers and TaqMan™ probes used for 3C analysis

From: Spatial organization of the chicken beta-globin gene domain in erythroid cells of embryonic and adult lineages

  Primers for MboI 3C analysis
HS4 (anchor) GAGAATCGGGTGCAGGCTT
HS4 -|- HS3 GCGTGGATAGAAGTAAACTGGAA
HS3 GCAGTCCCAGGTTGCACAA
HS2 (anchor) CACCGTCAGCATACATTGCT
HS2 -|- HS1 CAGGACCACCGTTACCCAT
HS1 TCAGGAACCGTGGGTGTGT
HS1 -|- Rho ACAACTCCAAGGGATGAAGC
Rho (anchor) AGGGAGACTACGAATGCTGC
Rho -|- betaH AATGGAAAGGTTCTGTCTCAGC
BetaH CTGAGCCCCACCCTGATG
BetaH -|- BetaA ACTATGTCCATCCCAGCTCCA
BetaA (anchor) AGCCCCACTGCCATCCTT
BetaA -|- Beta/eps enh TCACGGAGCACCTACAACCA
Beta/eps enh (anchor) CTATCAAGACTTGCACAGACCTT
Beta/eps enh -|- Epsilon AGTGATTCTATGGAGGAAGGCA
Epsilon (anchor) GCGACAAGTTGCACGTGG
3′HS (anchor) GGGCATTTCTACAGAGAGCAA
Downstream to 3′HS CCACATCTGCCAAGAGCCT
ERCC3 test CAAATCTGACAGCCGCTTAGA
ERCC3 (anchor) CTCGATGAAGTACATACTATTCCTG
  Primers for NlaIII 3C analysis
HS4 GTGGATTGAAGGATGCTGAG
HS4 -|- HS3 CCAAAGGACCCCAGGACTA
HS3 TGACACAGCACAAAAGTGAGC
HS3 -|- HS2 AGCAATGTATGCTGACGGTG
HS2 AAATACATCCCATCCTGGTGTTC
HS2 -|- HS1 CAGGAAAAGCCTTACTTCAAATG
HS1 CCGCTGCTCAGTGTCACAC
HS1 -|- Rho CGAAGTAGGGAACCTCAACA
Rho AGGAGGGGAGTAAAAGGGAG
BetaH CCCTGAACGATGAGTAGGAAGT
BetaA CAGCTCTGCAGCTCTATACCG
Beta/eps enh TTAATCCTCCCTGGATCATTTC
Beta/eps enh -|- Epsilon GCTCTGCTTACATTCACATCCA
Epsilon (anchor) AGCGCTGCCCTACCAGAC
Epsilon -|- 3′HS AGCAGCCTGCAGAGGGAT
3′HS GGGCATTTCTACAGAGAGCAA
ERCC3 test CAAATCTGACAGCCGCTTAGA
ERCC3 (anchor) CTCGATGAAGTACATACTATTCCTG
  TaqMan™ probes for MboI 3C analysis
HS4 FAM-ATTCCCTGTCC(T-BHQ1)GTCCCACAGCTGT-PO4
HS2 FAM-AATTTGTGA(T-BHQ1)GGACTTCAGGCCCAT-PO4
Rho FAM-AAAGGAGCTGAC(T-BHQ1)CATGCTAGCCCAG-PO4
BetaA FAM-TTTGCCTCC(T-BHQ1)TTGGGAACCTCTCC-PO4
Beta/eps enh FAM-CAGTTCTCCGAG(T-BHQ1)CTGACTTTGGAGTCT-PO4
Epsilon FAM-TTTGCCTCC(T-BHQ1)TTGGGAACCTCTCC-PO4
3′HS FAM-CAGTTCTCCGAG(T-BHQ1)CTGACTTTGGAGTCT-PO4
ERCC3 FAM-TGGAGTGGCT(T-BHQ1)AAAAGTCGAGAGTGG-PO4
  TaqMan™ probes for NlaIII 3C analysis
HS2 FAM-AAGTG(T-BHQ1)CCCAGCTCCTGTTCTCCCAC-PO4
Epsilon FAM-CCTTTCTC(T-BHQ1)GAAAAGGGGCCCAGGT-PO4
ERCC3 FAM-TGGAGTGGCT(T-BHQ1)AAAAGTCGAGAGTGG-PO4
  1. 5′-3′ sequences are presented. Sequences [GenBank:NW_001471556] for β-globin and [GenBank:NC_006094] for ERCC3 primers were used. Symbol ”-|-”designates primers located in linkers between functional elements within the domain.