Skip to main content

Table 1 Primers and TaqMan™ probes used for analysis of β-globin primary transcripts and β-actin mRNA levels

From: Spatial organization of the chicken beta-globin gene domain in erythroid cells of embryonic and adult lineages

Primers
Rho F CAGAACACTGGGGTTTGGCT
Rho R GGCCAGCACAATGATGAGG
BetaH F CCAGAGGTTCTTTGCGTCC
BetaH R CTCAGTCCTATAACTCCTGCCTA
BetaA F TACACTTCTGTTCCCCATCTCTC
BetaA R CCAAAGGACGCAAAGAACC
Epsilon F TAGGCAAAGAGTGAGCATTCG
Epsilon R GCCAGGACGATGATCAGGAT
Beta-actin F TGGACTCTGGTGATGGTGT
Beta-actin R TCTCTCTCGGCTGTGGTGG
TaqMan™ probes
Rho FAM-CTCCACACC(T-BHQ1)TGCTTACCCCATTG-PO4
BetaH FAM-ACAACA(T-BHQ1)CAAGAAGAGCTTTGCCCAG-PO4
BetaA FAM-CTGATCGTC(T-BHQ`)ACCCCTGGACCCAGA-PO4
Epsilon FAM-CTGTGCTTGG(T-BHQ1)GGGAAGAGGGGAT-PO4
Beta-actin FAM-TCTATGAAGGC(T-BHQ1)ACGCCCTCCCCC-PO4
  1. 5′-3′ sequences are presented. Sequences [GenBank:NW_001471556] for β-globin and [GenBank:NC_006101] for β-actin primers were used.