Skip to main content

Table 2 Primers used in this study.

From: Quantitative analysis of polycomb response elements (PREs) at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

Primer Direction Sequence (5'→3') Enzyme site
Primers for transgenic constructs  
vg1.6 kb Forward TAAAGCGGCCGC AAGTCTCCGCCCAATAAT NotI
vg Δ100 Forward TAAAGCGGCCGC AGTTTGTGTGAGAGTGAGC NotI
vg Δ300 Forward TAAAGCGGCCGC CGTAATTAAAACCGAAGG NotI
vg 1.6 kb, vg Δ100, vg Δ300 All reverse GCGCTTTCTA GAGAGCATATAGAAGTGGTCGAA XbaI
Fab-7 Forward TAAAGCGGCCGC GGAATTGTGTGGACGATG NotI
Fab-7 Reverse GGCGCTTACTAGTGCACAGAGAGTGCAGAAAG' SpeI
Primers for mutagenesis   
vg ΔGAGA Forward AAGAGGTTGAACCCCTTGAGGAAACCGGTTTATTTC -
vg ΔGAGA Reverse GAAATAAACCGGTTTCCTCAAGGGGTTCAACCTCTT -
vg Δ1stGT Forward CAGGAAACCGGTTTATTTCCACAACTCTGTGCGTG -
vg Δ1stGT Reverse CACGCACAGAGTTGTGGAAATAAACCGGTTTCCTG -
vg Δ1st-2ndGT Forward GGTTTATTTCCACAACTCCGTGTGTGCGTTTATGCC -
vg Δ1st-2ndGT Reverse GGCATAAACGCACACACGGAGTTGTGGAAATAAACC -
vg Δ1st-3rdGT Forward GT TTATTTCCACAACTCCCGTTTATGCCTGTGTGCG -
vg Δ1st-3rdGT Reverse CGCACACAGGCATAAACGGGAGTTGTGGAAATAAAC -
vg Δ1st-4thGT Forward CAACTCCCGTTTATGCCCGCTAGTTTGTGTGAGA -
vg Δ1st-4thGT Reverse TCTCACACAAACTAGCGGGCATAAACGGGAGTTG -
  1. Bold sequences refer to primer tags that contain a restriction site (named in following column).