Skip to main content

Table 2 List of primers

From: Histone variant macroH2A1 deletion in mice causes female-specific steatosis

Primer name 5' → 3'  
  Forward Reverse
5'' recombination arm AGCTCGAGCTAGAATGGTGAACAGGTTGGAAGG TTGTCGACAAACAGATCAGCGAGCTCACTGC
3' recombination arm AGCTCGAGCTGGTCTGCACACATCCTTTAAGG ACAGGAGTCAAGATGGTGGCTGGG
Dlg3* CTATGGGACCAGCATCCAGT TGTGCTTGCTGCAGTCTCTT
Tbg* AAGGCTGTGCTACACATTGG CGGATAACAGGGTGAAGAGG
Lpl* GAGCGAGAACATTCCCTTCA TCTGAGTCTCTCCGGCTTTC
CD36* GCAAAGTTGCCATAATTGAGTCC GTCTGTGCCATTAATCATGTCG
Thrsp* GAGTGCATCTGTGGACTTGG GAGTAACTGCGACATGACACC
GAPDH* CAACTACATGGTCTACATGTTC CGCCAGTAGACTCCACGAC
18S* CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT
  1. *Reverse transcriptase PCR.