Skip to main content

Advertisement

Table 2 Non-coding RNA strand-specific reverse transcription and polymerase chain reaction primers.

From: Transcription-dependent silencing of inducible convergent transgenes in transgenic mice

Linker CGACTGGAGCACGAGGACAC
A as RT CGACTGGAGCACGAGGACACCAGAGCCCTGAACCTGTTTC
A as R ATGTAAACCTTCGTTATGTGATG
A s RT CGACTGGAGCACGAGGACACATGTAAACCTTCGTTATGTGATG
A s Rev CAGAGCCCTGAACCTGTTTC
B as RT CGACTGGAGCACGAGGACACTGACACAGGTGGCTATCCTCTGGAA
B as Rev CCTGAGAATCTCTGAATCCCCA
B s RT CGACTGGAGCACGAGGACACCCTGAGAATCTCTGAATCCCCA
B s Rev CACAGGTGGCTATCCTCTGGAA
J as RT CGACTGGAGCACGAGGACACAGGCTGAGGTCATGGACTT
J as Rev GCCCTAAAGCCTCCCCACC
C as RT CGACTGGAGCACGAGGACACTGATGAGAAGGCTGGGAGGCTG
C as Rev GGTTTTCTGTTTTGGCTTGCT
C s RT CGACTGGAGCACGAGGACACTGACAGCCTCCCAGCCTTCTCA
C s Rev GGGGTGGGGAGGCTTTAG