Skip to main content

Table 1 Real time polymerase chain reaction (PCR) primers.

From: Transcription-dependent silencing of inducible convergent transgenes in transgenic mice

Real time PCR primers
ChIP primers
h GM-CSF intron 2 (+ 469 to 533 bp) ATGGCAGTCACATGAGCTCCTT
  1. GM-CSF, granulocyte-macrophage colony-stimulating factor; GAPDH, glyceraldehyde phosphate dehydrogenase