Skip to main content

Advertisement

Table 1 Real time polymerase chain reaction (PCR) primers.

From: Transcription-dependent silencing of inducible convergent transgenes in transgenic mice

Real time PCR primers
h GM-CSF mRNA CACTGCTGCTGAGATGAATGAAA
  GTCTGTAGGCAGGTCGGCTC
m GM-CSF mRNA ATGCCTGTCACGTTGAATGAAG
  GCGGGTCTGCACACATGTTA
m GAPDH mRNA TGGTGAAGCAGGCATCTGAG
  TGTTGAAGTCGCAGGAGACAAC
ChIP primers
h GM-CSF enhancer GGAGCCCCTGAGTCAGCAT
  CATGACACAGGCAGGCATTC
h GM-CSF promoter TGTCGGTTCTTGGAAAGGTTCA
  TGTGGAATCTCCTGGCCCTTA
h GM-CSF intron 2 (+ 469 to 533 bp) ATGGCAGTCACATGAGCTCCTT
  TGAAGTGACCCCCACTTTACCA
m CD2 promoter CTCTCTCCTTCCCCATCTCTACCT
  CAACCTGAACCACGTGTCTTTC
m chromosome 1 (mChrom1) CATAGATGAAGCTGCCACATAGGT
  GTGGGCAAGGACAAAGCATTA
  1. GM-CSF, granulocyte-macrophage colony-stimulating factor; GAPDH, glyceraldehyde phosphate dehydrogenase