Skip to main content

Table 1 Primer sets used in the experiments

From: Dynamic instability of genomic methylation patterns in pluripotent stem cells

Name Sequence 5'→3'
Nested primers for bisulfite analysis of Mo-MLVGFP long terminal repeat
GFPF1 TTTTTTTATATATTATTATTTATTTTTTTT
GFPR1 ATCAATCACTCAAAAAAAACCCTC
GFPF2 TAGGGTTAAGAATAGATGGAATAGTTGA
Bisulfite analysis of Oct4 promoter
Oct4F1 TGAGGAGTGGTTTTAGAAATAATTG
Oct4R1 AAACCAAATATCCAACCATAAAAAA
Oct4R2 CCAACCATAAAAAAAATAAACACC
Mo-MLV42bp/GFP creation1
Forward TTATACTCCTCCACACACCATCACTCACTCTTTCTCAATCCA
Reverse TGGATTGAGAAAGAGTGAGTGATGGTGTGTGGAGGAGTATAA
  1. 1Moloney murine leukemia virus (Mo-MLV)42bp/GFP was created by inserting this synthetic oligonucleotide into the U3 region of the Mo-MLV long terminal repeat.