Skip to main content

Table 1 List of primers used for RACE and ChIP assays

From: MacroH2A subtypes contribute antagonistically to the transcriptional regulation of the ribosomal cistron during seasonal acclimatization of the carp fish

Name Primer sequence 5'→3'
RACE primers
Macro1F ATGTCCAGTCGTGGAGGGAAG
Macro1R TTAGTTTGCGTCGAGTTTGGC
Macro2F ATGTCAGCCAGAGGAGGAAAG
Macro2R TCACTTGGCGTCCATCTTTGC
ChIP primers
IGSF CAAGTTCCTGAGCCTCGGC
IGSR GTGGATGAAAGTTTGACCGG
PromF CCTCAGGCCGCTGTGGGC
PromR: GTCTGAGTCTCCCAAGGAAGG
Cc5.8F GTCGATGAAGAACGCAGCTA
Cc5.8R GCAAAGTGCGTTCGAAGTGT
Cc28F GATTCCCTCAGTAGCGGCGA
Cc28R GCCTGAATTACTGCAGCAATG
CcL41F GCAAACTCGCCTGACCTTAAC
CcL41R GCCTGAATTACTGCAGCAATG
CcPlctF CCTGGAGTGCAAGACTCATTGCAT
CcPlctR GCAGTCTGATTTCCTCTCTTGAGC
16SF GGGGTTTACGACCTCGATGTT
16SR GCTTTAAGTATGGGCCCCCCT