Skip to main content

Table 1 Oligos used in the assays

From: A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

Gene name Oligo name Sequence 5'→3'
SEPT9 Forward GATT-X-GTTGTTTATTAGTTATTATGT
  Reverse AAATAATCCCATCCAACTA
  Blocker GTTATTATGTTGGATTTTGTGGTTAATGTGTAG-C3
  Probe FAM-TTAACCGCGAAATCCGAC-BHQ1
  Oligo 27 ttattagttattatgt
  Oligo 28 cggatttcgcggttaacg
  Oligo 45 cgcgttaaccgcgaaatcc
TMEFF2 Forward GGTTATTGTTTGGGTTAATAAATG
  Reverse AAAAAAAAAAAACTCCTCTACATAC
  Blocker ACATACACCACAAATAAATTACCAAAAACATCAACAA-C3
  Probe FAM-TTCGGACGTCGTTGTTCGG-BHQ1
  Oligo 30 gttaataaatggagtt
  Oligo 44 gaacaacgacgtcc
  Oligo 62 cgtcgttgttcggt
  1. X = tetrahydrofuran-type abasic site.