Skip to main content

Table 1 Primers and polymerase chain reaction (PCR) conditions for bisulphite methylation analysis

From: Dicer regulates Xist promoter methylation in ES cells indirectly through transcriptional control of Dnmt3a

Region/gene Primer, forward Primer, reverse PCR conditions
Xist, region 1A – 1st round MM3, gttaattaatgtagaagaatttttagtgttta MM2, aaatattcccccaaaactccttaaataa 94°C for 15 minutes; (94°C for 20 seconds; 54°C for 30 seconds; 72°C for 90 seconds) × 25 cycles; 72°C for 5 minutes
Xist, region 1A – nested Tag 6F, aggaagagag ttgtaaaataggataattttttattat T7 6R, cagtaatacgactcactatagggagaaggct atattcccccaaaactccttaaata 94°C for 15 minutes; (94°C for 20 seconds; 54°C for 30 seconds; 72°C for 30 seconds) × 5 cycles; (94°C for 20 seconds; 60°C for 30 seconds; 72°C for 30 seconds) × 25 cycles; 72°C for 5 minutes
Xist, region 2C Tag 1F, aggaagagag attttgtttttaaattgagtgggtg T7 1R, cagtaatacgactcactatagggagaaggct taaaccctatcccctaatcctctac 94°C for 15 minutes; (94°C for 20 seconds; 60°C for 30 seconds; 72°C for 1 minute) × 5 cycles; (94°C for 20 seconds; 68°C for 30 minutes; 72°C for 1 minute) × 40 cycles; 72°C for 5 minutes
Xist, region 2D Tag 5F, aggaagagag agggtgtgtgtgtatatggattttt T7 MM5, cagtaatacgactcactatagggagaaggct taactcaaacataaaactaacatataacaca 94°C for 15 minutes; (94°C for 20 seconds; 54°C for 30 seconds; 72°C for 1 minute) × 5 cycles; (94°C for 20 seconds; 58°C for 30 seconds; 72°C for 1 minute) × 40 cycles; 72°C for 5 minutes
Igf2r Tag Igf2r_F2, aggaagagag gtgtggtatttttatgtatagttagg T7 Igf2r_R cagtaatacgactcactatagggagaaggct aaatatcctaaaaatacaaactacac 94°C for 15 minutes; (94°C for 20 seconds; 54°C for 30 seconds; 72°C for 1 minute) × 45 cycles; 72°C for 5 minutes
H19A Tag H19A, aggaagagag gagaaaatagttattgtttatagtttt T7 H19A, cagtaatacgactcactatagggagaaggct cctaaaatactaaacttaaataacccacaa 94°C for 15 minutes; (94°C for 20 seconds; 50°C for 30 seconds; 72°C for 1 minute) × 45 cycles; 72°C for 5 minutes
H19B Tag H19A, aggaagagag ttagtgtggtttattataggaaggtatagaagt T7 H19A, cagtaatacgactcactatagggagaaggct taaacctaaaatactcaaactttatcacaac 94°C for 15 minutes; (94°C for 20 seconds; 50°C for 30 seconds; 72°C for 1 minute) × 5 cycles; (94°C for 20 seconds; 58°C for 30 seconds; 72°C for 1 minute) × 40 cycles; 72°C for 5 minutes